single guide rna sgrna (Synthego Inc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Synthego Inc single guide rna sgrna
Single Guide Rna Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+sgrna/sgrna/pmc13273111-269-6-22
Average 86 stars, based on 1 article reviews

single guide rna sgrna - by Bioz Stars, 2026-09

86/100 stars

Images

Sequencing:

Article Title: Pyridoxine supplementation confers protection against SGPL1 R222Q variant sphingosine phosphate lyase insufficiency syndrome
Article Snippet: .. We designed a single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego), on mouse exon 7. .. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the SGPL1 c.665G>A SPLIS variant, flanked by 92 bases on the 5’side and 106 bases on the 3’ side: 5’ AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAGG TGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTTG GCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCCC TTCTGATATTGTCTATTTGTGGCAGCAC 3’ (IDT).

Synthesized:

Article Title: Intron retention regulates STAT2 function and predicts immunotherapy response in lung cancer
Article Snippet: STAT2 -targeting gRNA was designed using the CRISPR Design Tool ( https://design.synthego.com/ #/ , Synthego) using the Ensembl GRCh38.p10 human genome build targeting STAT2 ( Table S4E ). .. Single guide RNA (sgRNA) with standard chemical modifications (2’-O-methylated nucleotides and phosphothiorate linkages in the first and last three bases) targeting the relevant sequences were synthesized (Synthego). .. 16 μg of sgRNA was incubated with 20 μg of Alt-R HiFi Cas9 Nuclease V3 (IDT #1081060) for 30 minutes at room temperature.

Article Title: Humanized Kcnv2 E151X Mouse Captures Hallmarks of KCNV2-Associated Retinal Dystrophy
Article Snippet: .. A single guide RNA (sgRNA) was synthesized by Synthego (Redwood City, CA, USA) and assembled into a ribonucleoprotein complex with Cas9 nuclease. ..

Generated:

Article Title: Viral infection and brain inflammation with seizures in PARK7 deficiency
Article Snippet: .. Briefly, ribonucleoprotein (RNP) complexes were generated by incubating 1.2 μg Cas9 protein (Integrated DNA Technologies) with 2 μg single guide RNA (sgRNA) (Synthego) at room temperature for 15–20 min. 100,000–200,000 cells were washed with PBS, resuspended in 20 μl of OPTI-MEM (Thermo Fisher Scientific), mixed with the RNP complexes, and transferred into a Nucleocuvette strip chamber (Lonza) and nucleofected using the Lonza 4D-Nucleofector System (program CA137 for SH-SY5Y and program CM138 for A549). ..

Stripping Membranes:

Incubation:

Article Title: Comparative analysis of CRISPR-Cas9, lentiviral transduction, and base editing for sickle cell disease in a murine model
Article Snippet: .. Single-guide RNA (sgRNA) (CUAACAGUUGCUUUUAUCAC), targeting the +58 BCL11A enhancer obtained from Synthego (Synthego, Redwood City, CA) was mixed with 2 × NLS SpCas9 protein (MacroLab, CA) to form ribonucleoprotein (RNP) complexes, and incubated at room temperature for 15 minutes. .. Then RNP complexes (5-7.5 μM) were introduced into cells via electroporation using the HSC-3 program on a MaxCyte ATX electroporator (MaxCyte, Rockville, MD) at a cell density of 50 × 10 3 /μL.

Knock-Out:

Article Title: The miR-16-1-3p suppresses proliferation and invasiveness via the MDM2-p53 axis in TGF-β1 signaling in osteosarcoma
Article Snippet: .. To generate TP53-knockout U2OS cells, an single-guide RNA (sgRNA) targeting an early exon of the human TP53 gene was designed using the Synthego Knockout Guide Design Tool. ..

Review